Skip to main content

Table 1 RT-qPCR primer sequences

From: Laminin 221 fragment is suitable for the differentiation of human induced pluripotent stem cells into brain microvascular endothelial-like cells with robust barrier integrity

GenesForward primer sequence (5′ → 3′)Reverse primer sequence (5′ → 3′)
CDH5GATTTGGAACCAGATGCACAACTTGGCATTCTTGCGACTC
MDR1CCCATCATTGCAATAGCAGGTGTTCAAACTTCTGCTCCTGA
BCRPAGATGGGTTTCCAAGCGTTCATCCAGTCCCAGTACGACTGTGACA
GLUT1GAAGAGAGTCGGCAGATGATGGGAGTAATAGAAGACAGCGTTGATG
OccludinTCCAATGGCAAAGTGAATGAGCAGGTGCTCTTTTTGAAGG
ZO-1CGAGGGATAGAAGTGCAAGTAGATATTCTTCATTTTTCCGGGATTT
LAT1AATGGGTCCCTGTTCACATCCGTAGAGCAGCGTCATCACA
HPRT1CTTTGCTTTCCTTGGTCAGGTCAAGGGCATATCCTACAACA
PECAM1AGTCGGACAGTGGGACGTATATGACCTCAAACTGGGCATC
vWFCGGCTTGCACCATTCAGCTATGCAGAAGTGAGTATCACAGCCATC
KDRCTGCAAATTTGGAAACCTGTCGAGCTCTGGCTACTGGTGATG
TBXTACCCAGTTCATAGCGGTGACCAATTGTCATGGGATTGCAG
KDRCTGCAAATTTGGAAACCTGTCGAGCTCTGGCTACTGGTGATG
OCT-4AGCGAACCAGTATCGAGAACTTACAGAACCACACTCGGAC
NANOGCTGCAGAGAAGAGTGTCGCAACCAGGTCTTCACCTGTTTG