Skip to main content

Table 1 Primers used for gene expression analysis

From: Processing mechanism of guanidinoacetate in choroid plexus epithelial cells: conversion of guanidinoacetate to creatine via guanidinoacetate N-methyltransferase and monocarboxylate transporter 12-mediated creatine release into the CSF

Genes Gene bank accession number Orientation Primer sequence (5′–3′) Product size
MCT12 NM_001191637.1 Forward AGCCTTCCTTCTTTGTGG 179 bp
Reverse TCTGATCTAACTCCTTCGC
GAMT NM_012793.2 Forward TCTGACACGCACCTGCAGATCC 584 bp
Reverse GCATAGTAGCGGCAGTCGGCTG
β-Actin NM_031144.3 Forward TCATGAAGTGTGACGTTGACATCCGT 285 bp
Reverse CCTAGAAGCATTTGCGGTGCACGATG