Skip to main content

Table 1 List qRT–PCR mouse primer sequences

From: Human ES-derived MSCs correct TNF-α-mediated alterations in a blood–brain barrier model

Gene Forward (5′–3′) Reverse (5′–3′)
RPL-19 CGCTGCGGGAAAAAGAAG CTGATCTGCTGACG GAGTTG
CLN-5 TGCCGCGAACAGTTCCTAC CCAGCTGCCCTTTCAGGTTA
ZO-1 CTCGGAAAAATGAAGAATATGGTC CACCATCTCTTGCTGCCAAA
Occludin GGACTGGGTCAGGGAATATCC GCAGACCTGCATCAAAATTTCTC
VE-cadherin CACTGCTTTGGGAGCCTTC GGGGCAGCGATTCATTTTTCT
ICAM-1 GGTGACTGAGGAGTTCGACAGAA ACCGGAGCTGAAAAGTTGTAGACT
VCAM-1 GTGACTCCATGGCCCTCACT CGTCCTCACCTTCGCGTTTA
CCL2 GGCTCAGCCAGATGCAGTTAA CC GCCTACTCATTGGG TCA
CXCL12 GCTCCTCGACAGATGCCTTG GACCCTGGCACTGAACTGGA