Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primer sequences used for RT-qPCR analysis

From: Transfection of brain capillary endothelial cells in primary culture with defined blood–brain barrier properties

Primer Reference sequence Forward primer Reverse primer
Claudin-5 NM_031701.2 CTACAGGCTCTTGTGAGGACTTGAC AGTAGGAACTGTTAGCGGCAGTTTG
Occludin NM_031329.2 CTGACTATGCGGAAAGAGTCGACAG AGAGGAATCTCCTGGGCTACTTCAG
PECAM-1 NM_031591.1 ATTCTATAAGGACGATGCGCTGGTG GCTGTTCAGTATCACGGTGCATTTG
TfR 1 NM_022712.1 TGGATCAAGCCAGATCAGCATTCTC TTTCTTCCTCATCTGCAGCCAGTTT
ABCG2 NM_181381.2 GAGTTAGGCCTGGACAAAGTAGCAG AAGAGGATGGAAGGGTCAGTGATGA
ABCB1 NM_012623.2 AATCAACAGTACACAGACCGTCAGC CCAAAGTGAAACCTGGATGTAGGCA
HcRed1-C1 pHcRed1-C1 (613-1377) ATGTACATGGAGGGCACCGTGAA GTCACGTGGATTCTCATGCTCTGG
β-actin NM_031144.3 CCTCTGAACCCTAAGGCCAACCGTGAA AGTGGTACGACCAGAGGCATACAGGG