Skip to main content

Advertisement

Table 1 Primer sequences and the expected size of the PCR products.

From: Expression and functional activity of nucleoside transporters in human choroid plexus

Gene of interest NCBI Accession number Position in the mRNA Amplicon length Amplicon sequence Probe sequence
hENT1 NM_001078174 358-433 75 ACAGATACAAAGCGTCT GGCTT ATCTTCTTCATGCTG GGTCTGGGAACGCTGCTC CCGTGGAATTTTTTCATGA CAGCCTCAGGACAGATACAAAGCTG
hENT2 NM_001532 1290-1400 110 CAGACGAGGACAGCCGG CTGCTGCCCCTGCTGGTCTGCCTGCGGTTCCTGTTCGTGCCCCTCTTCATGCTGTGCCACGTGCCCCAGAGGTCCC GGCTGCCCATCCTCTTCC CTTACTTCCTGTGGCCAGACGAGGA
hENT3 NM_018344 827 - 909 82 CCAGGTACTACATGAGGCCTGTTCTTGCGGCCCATGTGTTTTCTGGTGAAGAGGAGCTTCCCCAGGACTCCCTCAGTGCCCC GGAGTATGCCAGGTACTACATGAGG
hCNT1 NM_201651 391 - 463 72 GAACCTGCAGCCAGCCCTGA GAGCCAGAAGCTTCTG CAGGGAGCACATGCAGCTGTTTCGATGGATCGGCAC TCCAGATGGAGGAACCTGCAGCCAG
hCNT2 NM_004212 236 - 301 65 TCGGTGGCCTTTCAGCAAAGCAAGAAGTTTCTGCAAAACACACGCCAGATTGTTCAAGAAGATCC ACTTACCAGAGGAGGAGTCGGTGGC
hCNT3 NM_022127 617-718 101 GGTG ATCTGGAGCTCCCT GGTCCT AGCAGTTATTTTCTG GTTGGCCTTTGACACTGCCAAATTGGGTCAACAGCAGCTGGTGTCCTTCGGTGGG CTCATAA CTGGCTGAAGTGGGTGATCTGGAGC
18 S X03205 609-796 187 G GTGCCAGCAGCCGCG GTAATTCCAGCTCCAATAGCGTATA TTAAAGTTGCTGCA GTTAAAAAGCTCGTAGTTGGATCTTGGGAGCGGGCGGGCGGTCCGCCGCGAGGCGA GCCACCGCCCGTCC CCGCCC CTTGCCTCTCGG CGCCCCCTCGATGCTCTTAGCTGAGTGTCCCGCGGGGC CCGAAG ACTTGCTCTTGGACAGGAACCAGGG